Journal: Molecular oral microbiology

Article Title: Tannerella forsythia produced methylglyoxal causes advanced glycation endproducts (AGEs) accumulation to trigger cytokine secretion in human monocytes

doi: 10.1111/omi.12224

Figure Lengend Snippet: MGO in the spent media from the wild-type (Tf43037) and the mutant TFM-1726 strains was estimated by ELISA (a) and HPLC (b); sterile medium (TFB) was used as control. For HPLC, MGO was measured as the 6, 7-dimethoxy-2-methylquinoxaline derivative and Hexanedione (HDO) used as an internal standard was measured as 6, 7-dimethoxy-2-methyl-3-pentylquinoxaline derivative. *P< 0.05 ***P< 0.001.

Article Snippet: One such isogenic mutant, named TFM-1726 was selected for future analysis. table ft1 table-wrap mode="anchored" t5 caption a7 Primer DNA sequence (‘5-‘3) TfmgsA 1F GCGCCTTTTCGATTAACG TfmgsA 2R ATGGAGCATCGTGCTCGGA TfmgsA 3R CAATTTCTTTTTTGTCAT ATCGTCAGTTTTTATGTATTCGTAC underlined text indicates overlap region with ermF TfmgsA 4F ATAAAAACTGACGAT ATGACAAAAAAGAAATTGCCC underlined text indicates overlap region with Tf43037 genomic DNA TfmgsA 5R TAGCGATATCCCGCT CTACGAAGGATGAAATTTTTC underlined text indicates overlap region with Tf43037 genomic DNA TfmgsA 6F TTTCATCCTTCGTAG AGCGGGATATCGCTAAAAAGT underlined text indicates overlap region with ermF Open in a separate window List of primers used in the study Characterization of methylglyoxal production MGO in spent media from the T. forsythia 43037 and TFM-1726 strains was quantified by an ELISA kit (MGO Competitive EIA Kit, LifeSpan Biosciences) as per manufacturer’s instructions and by a high-performance liquid chromatography (HPLC) based quantitative assay described by McLellan et al. 22 with minor modifications.

Techniques: Mutagenesis, Enzyme-linked Immunosorbent Assay, Sterility, Control

Journal: Disease Markers

Article Title: Association of Serum Lipocalin-2 Concentrations with Psoriasis and Psoriatic Arthritis: An Updated Meta-Analysis

doi: 10.1155/2019/7361826

Figure Lengend Snippet: The main features of included studies.

Article Snippet: Colak et al. [ ] , 2019 , Europe , Turkey , Caucasian , PsA , ELISA kit (double antibody sandwich ELISA method) test kit (Elabscience Biotech Co. Ltd.) , 50 , 5.20 , 2.67 , 36 , 1.94 , 2.09 , Healthy , 7.

Techniques: Control, Enzyme-linked Immunosorbent Assay, Sandwich ELISA

Journal: Frontiers in Immunology

Article Title: Characterization of young and aged ferrets as animal models for SARS-CoV-2 infection with focus on neutrophil extracellular traps

doi: 10.3389/fimmu.2023.1283595

Figure Lengend Snippet: Detection of NET markers in serum of young (A, C, E) and aged (B, D, F) ferrets. (A) Cell-free DNA in young ferrets. (B) Cell-free DNA in aged ferrets. (C) DNase-1 activity in young ferrets. (D) DNase-1 activity in aged. (E) Cathelicidin antimicrobial peptide (CAMP) ELISA in young ferrets. (F) CAMP ELISA in aged. Non-inf.: serum from all animals before infection. Inf.: serum from all the same animals after infection. Data were analyzed with a paired two-tailed t-test. Whiskers represent mean and standard deviation.

Article Snippet: The concentration of ferret cathelicidin antimicrobial peptide (CAMP) was determined with a canine CAMP competition ELISA kit (Cat. Nr. E08C0333, BlueGene Biotech., Shanghai, China).

Techniques: Activity Assay, Enzyme-linked Immunosorbent Assay, Infection, Two Tailed Test, Standard Deviation